Vectors tools study normal (13 resultados)

Idioma: Inglés
Editorial: Springer-Verlag Berlin and Heidelberg GmbH & Co. K, 1989
- Tapa dura
Librería: Ammareal, Morangis, FranciaAmmareal
Contactar con el vendedorVendedor de 5 estrellasCondición: Usado - Excelente
EUR 5,57
Envío por EUR 16,50Se envía de Francia a Estados Unidos de AmericaCantidad disponible: 1 disponibles
Hardcover. Condición: Très bon. Ancien livre de bibliothèque. Edition 1989. Ammareal reverse jusqu'à 15% du prix net de cet article à des organisations caritatives. ENGLISH DESCRIPTION Book Condition: Used, Very good. Former library book. Edition 1989. Ammareal gives back up to 15% of this item's net price to charity organizatio…ns.

- Tapa blanda
Librería: Ria Christie Collections, Uxbridge, Reino UnidoRia Christie Collections
Contactar con el vendedorVendedor de 5 estrellasCondición: Nuevo
EUR 116,63
Envío por EUR 14,00Se envía de Reino Unido a Estados Unidos de AmericaCantidad disponible: Más de 20 disponibles
Condición: New. In.

Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
NATO Advanced Research Workshop On "Vectors For Transfer And Expression Of Genes" (1988 : Wilsede, Germany); Dernick, Rudolf; Lother, Heinz; Heinrich-Pette-Institut Fur Experimentelle Virologie Und Immunologie; North Atlantic Treaty Organization. Scientific Affairs Division
- Tapa blanda
Librería: Romtrade Corp., STERLING HEIGHTS, MI, Estados Unidos de AmericaRomtrade Corp.
Contactar con el vendedorVendedor de 5 estrellasCondición: Nuevo
EUR 131,00
Gastos de envío gratisSe envía dentro de Estados Unidos de AmericaCantidad disponible: 1 disponibles
Condición: New. This is a Brand-new US Edition. This Item may be shipped from US or any other country as we have multiple locations worldwide.

- Tapa blanda
Librería: Basi6 International, Irving, TX, Estados Unidos de AmericaBasi6 International
Contactar con el vendedorVendedor de 5 estrellasCondición: Nuevo
EUR 131,42
Gastos de envío gratisSe envía dentro de Estados Unidos de AmericaCantidad disponible: 1 disponibles
Condición: Brand New. New. US edition. Expediting shipping for all USA and Europe orders excluding PO Box. Excellent Customer Service.

- Tapa blanda
Librería: Books Puddle, New York, NY, Estados Unidos de AmericaBooks Puddle
Contactar con el vendedorVendedor de 4 estrellasCondición: Nuevo
EUR 147,29
Envío por EUR 3,42Se envía dentro de Estados Unidos de AmericaCantidad disponible: 4 disponibles
Condición: New. pp. viii + 477.

- Tapa blanda
Librería: Books Puddle, New York, NY, Estados Unidos de AmericaBooks Puddle
Contactar con el vendedorVendedor de 4 estrellasCondición: Usado
EUR 156,58
Envío por EUR 3,42Se envía dentro de Estados Unidos de AmericaCantidad disponible: 1 disponibles
Condición: Used. pp. 475 1st Edition.

- Tapa blanda
Librería: Majestic Books, Hounslow, Reino UnidoMajestic Books
Contactar con el vendedorVendedor de 4 estrellasCondición: Usado
EUR 162,17
Envío por EUR 7,60Se envía de Reino Unido a Estados Unidos de AmericaCantidad disponible: 1 disponibles
Condición: Used. pp. 475.

- Tapa blanda
Librería: Revaluation Books, Exeter, Reino UnidoRevaluation Books
Contactar con el vendedorVendedor de 5 estrellasCondición: Nuevo
EUR 156,34
Envío por EUR 14,61Se envía de Reino Unido a Estados Unidos de AmericaCantidad disponible: 2 disponibles
Paperback. Condición: Brand New. reprint edition. 485 pages. 9.53x1.11x6.69 inches. In Stock.

- Tapa blanda
Librería: moluna, Greven, Alemaniamoluna
Contactar con el vendedorVendedor de 5 estrellasCondición: Nuevo
EUR 118,64
Envío por EUR 48,99Se envía de Alemania a Estados Unidos de AmericaCantidad disponible: Más de 20 disponibles
Condición: New. Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fuerExperimentelle Virologie u. Immunologie an.

- Tapa blanda
Librería: Biblios, frankfurt am main, HESSE, AlemaniaBiblios
Contactar con el vendedorVendedor de 4 estrellasCondición: Usado
EUR 167,73
Envío por EUR 9,95Se envía de Alemania a Estados Unidos de AmericaCantidad disponible: 1 disponibles
Condición: Used. pp. 475.

Idioma: Inglés
Editorial: Springer, Berlin, Springer Berlin Heidelberg, Springer, 2011
- Tapa blanda
Librería: AHA-BUCH GmbH, Einbeck, AlemaniaAHA-BUCH GmbH
Contactar con el vendedorVendedor de 5 estrellasCondición: Nuevo
EUR 146,51
Envío por EUR 64,17Se envía de Alemania a Estados Unidos de AmericaCantidad disponible: 2 disponibles
Taschenbuch. Condición: Neu. Neuware - Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is…triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . .

- Tapa blanda
- Impresión bajo demanda
Librería: Majestic Books, Hounslow, Reino UnidoMajestic Books
Contactar con el vendedorVendedor de 4 estrellasCondición: Nuevo
EUR 151,02
Envío por EUR 7,60Se envía de Reino Unido a Estados Unidos de AmericaCantidad disponible: 4 disponibles
Condición: New. Print on Demand pp. viii + 477 100 Figures.

- Tapa blanda
- Impresión bajo demanda
Librería: Biblios, frankfurt am main, HESSE, AlemaniaBiblios
Contactar con el vendedorVendedor de 4 estrellasCondición: Nuevo
EUR 154,68
Envío por EUR 9,95Se envía de Alemania a Estados Unidos de AmericaCantidad disponible: 4 disponibles
Condición: New. PRINT ON DEMAND pp. viii + 477.