Artículos relacionados a Vectors as Tools for the Study of Normal and Abnormal...

Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation: (closed)): 34 (Nato ASI Subseries H:) - Tapa blanda

 
9783642741999: Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation: (closed)): 34 (Nato ASI Subseries H:)
Tapa blanda
ISBN 10: 3642741991 ISBN 13: 9783642741999
Editorial: Springer, 2011

Sinopsis

Using the latest techniques of molecular genetics it is now possible to study the mechanisms of cell growth and differentiation at the molecular level. Especially the application of viral vectors to visualize and analyze gene expression, the techniques of stem cell manipulation as well as various results regarding the function of oncogenes or the role of cytokines and growth factors are discussed leading to new interpretations of the mechanisms which lead to normal or abnormal cell differentiation.

"Sinopsis" puede pertenecer a otra edición de este libro.

Reseña del editor

Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fürExperimentelle Virologie u. Immunologie an der Univ. Hamburg

Reseña del editor

Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa­ tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 • -96 -84 GGAGATTCCCC IL-2R (p55) . . .

"Sobre este título" puede pertenecer a otra edición de este libro.

Editorial
Springer
Año de publicación
2011
Idioma
Inglés
ISBN 10 
3642741991
ISBN 13 
9783642741999
Encuadernación
Tapa blanda
Número de páginas
492
Editor
Lother Heinz, Dernick Rudolf, Ostertag Wolfram
Contacto del fabricante
no disponible
Persona responsable
CMN Printpool Inh. Mathis Neumann
https://www.also.com/ec/cms5/en_6000/6000/index.jsp

Friedrich-Karl-Str. 9
Hamburg
Alemania