- Tapa blanda
- Nuevo

Librería: Rarewaves.com USA, London, London, Reino UnidoRarewaves.com USA
Vendedor de AbeBooks desde 11 de junio de 2025
Condición: Nuevo
EUR 16,04
Cantidad disponible: 1 disponibles
Añadir al carritoDescripción del artículo del vendedor
Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on SundayThe Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.'A superbly written explanation' Brian CoxThis same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer'The perfect primer on the past and future of DNA' Guardian'Susenseful, erudite and thrilling' Prospect'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial.…
N° de ref. del artículo LU-9780241954690
- Título
- Creation
- Autor
- Adam Rutherford
- Editorial
- Penguin Books Ltd, GB
- Año de publicación
- 2014
- Estado
- New
- Encuadernación
- Paperback
- Idioma
- inglés
- ISBN 10
- 024195469X
- ISBN 13
- 9780241954690
- Peso del artículo
- 191 gramos
Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.
'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday
The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.
'A superbly written explanation' Brian Cox
This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.
'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph
'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer
'The perfect primer on the past and future of DNA' Guardian
'Susenseful, erudite and thrilling' Prospect
'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain
'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili
'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times
'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk
'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts
'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome
'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
“Sinopsis” puede pertenecer a otra edición de este título.
Acerca del autor
“Acerca de” puede pertenecer a otra edición de este título.
Rarewaves.com USA
London, London, Reino Unido
Vendedor de AbeBooks desde 11 de junio de 2025
Tarifas de envío de Reino Unido a Estados Unidos de America
| Artículo | De 7 a 12 días hábiles | De 7 a 12 días hábiles |
|---|---|---|
| Primer artículo | EUR 0,00 | EUR 0,00 |
Métodos de pago
Información empresarial del vendedor
RAREWAVES.COM LIMITED
Elsley Court, 20-22 Great Titchfield Street
London, Reino Unido W1W 8BE
Derecho al desistimiento
Si es un consumidor, puede rescindir el contrato de acuerdo con lo siguiente. Por consumidor se entiende cualquier persona física que actúe con fines ajenos a su actividad comercial, empresarial, oficio o profesión.
Información sobre el derecho de desistimiento
Derecho legal de desistimiento
Tiene derecho a rescindir este contrato en un plazo de 14 días sin dar ningún motivo.
El periodo de desistimiento vencerá a los 14 días desde que usted, o un tercero que no sea el transportista e indicado por usted, adquiera la posesión física del último bien o del último lote o pieza.
Para ejercer el derecho de desistimiento, complete de forma electrónica y envíe una declaración clara en nuestro sitio web, desde "Mis compras" en "Mi cuenta". Le enviaremos sin demora un acuse de recibo de dicho desistimiento a través de un soporte duradero (por ejemplo, por correo electrónico).
Para cumplir con el plazo de desistimiento, basta con que envíe su comunicación relativa al ejercicio del derecho de desistimiento antes de que venza el periodo de desistimiento.
Efectos del desistimiento
Si rescinde este contrato, le reembolsaremos todos los pagos que hayamos recibido de usted, incluidos los gastos de envío (excepto los gastos adicionales que surjan si elige un tipo de envío que no sea el tipo de envío estándar más económico que ofrecemos).
Podemos hacer una deducción del reembolso por la pérdida de valor de cualquier bien suministrado, si la pérdida es el resultado de una manipulación innecesaria por su parte.
Efectuaremos el reembolso sin demoras indebidas y, a más tardar, 14 días después de que se nos informe de su decisión de rescindir este contrato.
Efectuaremos el reembolso utilizando el mismo medio de pago que utilizó para la transacción inicial, a menos que haya acordado expresamente lo contrario; en cualquier caso, no incurrirá en ningún cargo como resultado de dicho reembolso.
Podremos retener el reembolso hasta que hayamos recibido los bienes o hasta que nos haya presentado una prueba de que los ha devuelto, lo que ocurra primero.
Deberá devolver los bienes o entregarlos a Rarewaves.com USA, Unit 144 The Lightbox, 111 Power Road, W4 5PY, London, London, United Kingdom, sin demoras indebidas y, en cualquier caso, en un plazo máximo de 14 días a partir del día en que nos comunique su desistimiento del presente contrato. El plazo se cumple si devuelve la mercancía antes de que venza el periodo de 14 días. Tendrá que asumir los gastos directos de devolución de los bienes. Usted solo es responsable de la disminución del valor de los bienes como resultado de una manipulación distinta a la necesaria para establecer la naturaleza, las características y el funcionamiento de los bienes.
Excepciones al derecho de desistimiento
El derecho de desistimiento no se aplica a lo siguiente:
- La entrega de periódicos, diarios o revistas, con la excepción de los contratos de suscripción; y
- El suministro de contenido digital que no se proporcione en un soporte tangible (por ejemplo, en un CD o DVD) si, al hacer el pedido, aceptó que podíamos empezar a entregarlo y que no podría desistir una vez iniciada la entrega.
Condiciones de envío
Please note that we do not offer Priority shipping to any country.
We currently do not ship to the below countries:
Russia
Belarus
Ukraine
Please do not attempt to place orders with any of these countries as a ship to address - they will be cancelled.