Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.
'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday
The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.
'A superbly written explanation' Brian Cox
This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.
'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph
'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer
'The perfect primer on the past and future of DNA' Guardian
'Susenseful, erudite and thrilling' Prospect
'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain
'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili
'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times
'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk
'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts
'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome
'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
"Sinopsis" puede pertenecer a otra edición de este libro.
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
"Sobre este título" puede pertenecer a otra edición de este libro.
Librería: World of Books (was SecondSale), Montgomery, IL, Estados Unidos de America
Condición: Good. Item in good condition. Textbooks may not include supplemental items i.e. CDs, access codes etc. Nº de ref. del artículo: 00051972242
Cantidad disponible: 1 disponibles
Librería: Better World Books, Mishawaka, IN, Estados Unidos de America
Condición: Good. Used book that is in clean, average condition without any missing pages. Nº de ref. del artículo: 14502027-6
Cantidad disponible: 1 disponibles
Librería: Reuseabook, Gloucester, GLOS, Reino Unido
Paperback. Condición: Used; Good. Dispatched, from the UK, within 48 hours of ordering. This book is in good condition but will show signs of previous ownership. Please expect some creasing to the spine and/or minor damage to the cover. Nº de ref. del artículo: CHL1095869
Cantidad disponible: 1 disponibles
Librería: MusicMagpie, Stockport, Reino Unido
Condición: Very Good. 1766747154. 12/26/2025 11:05:54 AM. Nº de ref. del artículo: U9780241954690
Cantidad disponible: 1 disponibles
Librería: Better World Books Ltd, Dunfermline, Reino Unido
Condición: Very Good. Ships from the UK. Former library book; may include library markings. Used book that is in excellent condition. May show signs of wear or have minor defects. Nº de ref. del artículo: 10103157-6
Cantidad disponible: 3 disponibles
Librería: Better World Books Ltd, Dunfermline, Reino Unido
Condición: Good. Ships from the UK. Former library book; may include library markings. Used book that is in clean, average condition without any missing pages. Nº de ref. del artículo: GRP78703612
Cantidad disponible: 1 disponibles
Librería: Better World Books Ltd, Dunfermline, Reino Unido
Condición: Very Good. Ships from the UK. Used book that is in excellent condition. May show signs of wear or have minor defects. Nº de ref. del artículo: 40109620-20
Cantidad disponible: 1 disponibles
Librería: Grand Eagle Retail, Bensenville, IL, Estados Unidos de America
Paperback. Condición: new. Paperback. Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.Creation- The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.This same science has led to a technological revolution- the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind. Tells a story that uses science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a fresh solution. Shipping may be from multiple locations in the US or from the UK, depending on stock availability. Nº de ref. del artículo: 9780241954690
Cantidad disponible: 1 disponibles
Librería: Your Online Bookstore, Houston, TX, Estados Unidos de America
paperback. Condición: New. Nº de ref. del artículo: 024195469X-11-35423552
Cantidad disponible: 1 disponibles
Librería: Rarewaves.com USA, London, LONDO, Reino Unido
Paperback. Condición: New. Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on SundayThe Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.'A superbly written explanation' Brian CoxThis same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer'The perfect primer on the past and future of DNA' Guardian'Susenseful, erudite and thrilling' Prospect'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial. Nº de ref. del artículo: LU-9780241954690
Cantidad disponible: 2 disponibles