Librería:
Speedyhen, Hertfordshire, Reino Unido
Calificación del vendedor: 5 de 5 estrellas
Vendedor de AbeBooks desde 26 de noviembre de 2009
N° de ref. del artículo NW9780241954690
Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.
'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday
The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.
'A superbly written explanation' Brian Cox
This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.
'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph
'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer
'The perfect primer on the past and future of DNA' Guardian
'Susenseful, erudite and thrilling' Prospect
'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain
'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili
'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times
'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk
'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts
'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome
'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Acerca del autor: Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
Título: CREATION
Editorial: Penguin
Año de publicación: 2014
Encuadernación: Encuadernación de tapa blanda
Condición: NEW
Librería: WeBuyBooks, Rossendale, LANCS, Reino Unido
Condición: Very Good. Most items will be dispatched the same or the next working day. A copy that has been read, but is in excellent condition. Pages are intact and not marred by notes or highlighting. The spine remains undamaged. Nº de ref. del artículo: rev6785044868
Cantidad disponible: 1 disponibles
Librería: WeBuyBooks, Rossendale, LANCS, Reino Unido
Condición: Good. Most items will be dispatched the same or the next working day. A copy that has been read but remains in clean condition. All of the pages are intact and the cover is intact and the spine may show signs of wear. The book may have minor markings which are not specifically mentioned. Nº de ref. del artículo: rev5543284399
Cantidad disponible: 1 disponibles
Librería: Reuseabook, Gloucester, GLOS, Reino Unido
Paperback. Condición: Used; Good. Dispatched, from the UK, within 48 hours of ordering. This book is in good condition but will show signs of previous ownership. Please expect some creasing to the spine and/or minor damage to the cover. Nº de ref. del artículo: CHL1095869
Cantidad disponible: 1 disponibles
Librería: Reuseabook, Gloucester, GLOS, Reino Unido
Paperback. Condición: Used; Good. Dispatched, from the UK, within 48 hours of ordering. This book is in good condition but will show signs of previous ownership. Please expect some creasing to the spine and/or minor damage to the cover. Damaged book. Slightly damaged in some way typically, a grazed corner or torn cover. Nº de ref. del artículo: CHL10833143
Cantidad disponible: 1 disponibles
Librería: Anybook.com, Lincoln, Reino Unido
Condición: Good. This is an ex-library book and may have the usual library/used-book markings inside.This book has soft covers. In good all round condition. Please note the Image in this listing is a stock photo and may not match the covers of the actual item,350grams, ISBN:9780241954690. Nº de ref. del artículo: 8729070
Cantidad disponible: 1 disponibles
Librería: MusicMagpie, Stockport, Reino Unido
Condición: Very Good. 1777798475. 5/3/2026 8:54:35 AM. Nº de ref. del artículo: U9780241954690
Cantidad disponible: 1 disponibles
Librería: AwesomeBooks, Wallingford, Reino Unido
Paperback. Condición: Very Good. Creation: The Origin of Life / The Future of Life This book is in very good condition and will be shipped within 24 hours of ordering. The cover may have some limited signs of wear but the pages are clean, intact and the spine remains undamaged. This book has clearly been well maintained and looked after thus far. Money back guarantee if you are not satisfied. See all our books here, order more than 1 book and get discounted shipping. . Nº de ref. del artículo: 7719-9780241954690
Cantidad disponible: 1 disponibles
Librería: Bahamut Media, Reading, Reino Unido
paperback. Condición: Very Good. This book is in very good condition and will be shipped within 24 hours of ordering. The cover may have some limited signs of wear but the pages are clean, intact and the spine remains undamaged. This book has clearly been well maintained and looked after thus far. Money back guarantee if you are not satisfied. See all our books here, order more than 1 book and get discounted shipping. Nº de ref. del artículo: 6545-9780241954690
Cantidad disponible: 2 disponibles
Librería: Greener Books, London, Reino Unido
Paperback. Condición: Used; Good. **SHIPPED FROM UK** We believe you will be completely satisfied with our quick and reliable service. All orders are dispatched as swiftly as possible! Buy with confidence! Greener Books. Nº de ref. del artículo: 1981903
Cantidad disponible: 1 disponibles
Librería: Brit Books, Milton Keynes, Reino Unido
Paperback. Condición: Used; Very Good. ***Simply Brit*** Welcome to our online used book store, where affordability meets great quality. Dive into a world of captivating reads without breaking the bank. We take pride in offering a wide selection of used books, from classics to hidden gems, ensuring there is something for every literary palate. All orders are shipped within 24 hours and our lightning fast-delivery within 48 hours coupled with our prompt customer service ensures a smooth journey from ordering to delivery. Discover the joy of reading with us, your trusted source for affordable books that do not compromise on quality. Nº de ref. del artículo: 3631815
Cantidad disponible: 1 disponibles